Wuho/WDR4 deficiency inhibits cell proliferation and induces apoptosis via DNA damage in mouse embryonic fibroblasts

Chi-Chiu Leea,⁎, Tao-shih Hsieha,b

Abstract

Wuho known as WDR4 encodes a highly conserved WD40-repeat protein, which has known homologues of WDR4 in human and mouse. Wuho-FEN1 interaction may have a critical role in the growth and development, and in the maintenance of genome stability. However, how Wuho gene deletion contributes to cell growth inhibition and apoptosis is still unknown. We utilized CAGGCre-ER transgenic mice have a tamoxifen-inducible cre-mediated recombination cassette to prepare primary mouse embryonic fibroblasts (MEFs) with Wuho deficiency. We have demonstrated that Wuho deficiency would induces γH2AX protein level elevation, heterochromatin relaxation and DNA damage down-stream sequences, including p53 activation, caspase-mediated apoptotic pathway, and p21-mediated G2/M cell cycle arrest.

Keywords:
Wuho
DNA damage
Apoptosis
Cell cycle arrest p53

1. Introduction

Wuho belongs to the evolutionarily conserved family of WD repeat proteins and is encoded by wuho in Drosophila, TRM82 in yeast and WDR4 (hereafter called Wuho) in humans and mice [1]. We previously identified the gene in a Drosophila mutant strain that has a sterile phenotype (wuho means no progeny in Chinese) [2], and in a subsequent study, we found that Wuho functions as a guardian of genome stability at DNA replication forks in human and mouse cells [1]. The protein contains multiple WD40 repeats, and in yeast, it is known to form a disc-like structure with seven β-propeller blades [3].
The WD40 repeat domain is a common structural motif in eukaryotes that was first identified in the β-subunit of heterotrimeric Gproteins [4,5]. WD40 domains usually contain four to eight repeating sequences, which are separated by approximately 40 amino acids. Each repeat consists of two sites, including a poorly conserved site with a pair of glycine-histidine residues (GH) and a well-conserved site with a pair of tryptophan-aspartate residues (WD). Together, the WD40 repeats join to form circular β-propeller structures. These β-propellers act as scaffolds for protein-protein interactions and contribute to a wide range of functions [6,7], such as signal transduction, cell cycle regulation, RNA splicing, and transcription [8-10].
Flap endonuclease 1 (FEN1) functions at the replication fork in eukaryotes to remove 5′-RNA primers from the lagging strand. This protein has both slap and gap endonuclease activity, of which gap endonuclease activity can potentially introduce strand breaks at DNA replication sites [11]. A previous report indicated that Wuho guards mammalian genome stability by inhibiting the gap cleavage activity of FEN1 at the replication fork. This inhibition was shown to be essential for cell survival, as downregulation of Wuho resulted in accumulation of double-strand DNA breaks (DSBs) and programmed cell death [1].
The cell cycle and apoptosis are tightly controlled through interlinked cell signaling pathways. Among the factors that control the cell cycle, checkpoint machineries are the most important, and by coordinating with apoptotic and DNA repair mechanisms, these proteins form a circuitry that orchestrates the cellular response to DNA damage [12]. Checkpoints that arrest cell cycle progression can be activated in response to DNA damage and contribute to the maintenance of genome stability by allowing the cell time to repair DNA damage. By this mechanism, the cell can prevent the use of damaged or incompletely replicated chromosomes as material for genetic transmission [13,14]. Genomic stability, cell cycle and programmed cell death pathways are linked by the tumor suppressor gene, TP53 (encodes p53), and its downstream target gene CDKN1A (encodes p21WAF1/CIP1). Both p53 and p21 are mutifunctional proteins that can regulate apoptosis and cell cycle arrest through various actions [15–17].
A previous report showed that knockdown of Wuho expression by siRNA led to accumulation of DNA damage and apoptosis through the ATM/Chk2/p53 signaling pathway in both mouse and human cells [1]. Mouse embryonic fibroblasts (MEFs) are often used as a tool to analyze tissue-nonspecific effects of genetic modifications, since the cells are easily derived and maintained in a relatively low-maintenance anchorage-dependent cell culture system. This primary cell culture system is especially suited for evaluating the effects on cell proliferation caused by dysregulated Wuho gene function [18]. In this study, we established a Wuho-knockout system with inducible Cre-loxP recombination. Because knocking out Wuho is early embryonic lethal in mice [1], we used Wuho-knockout MEFs to examine the effects of Wuho deficiency on DNA damage, apoptosis, cell cycle distribution and cell signaling.

2. Materials and methods

2.1. Chemicals and reagents

Caspase-3/CPP32 inhibitor, Z-DEVD-FMK (1009-20C), Caspase-9/ Mch6 inhibitor, Z-LEHD-FMK (1074-20C), and Apo-BrdU-Red In Situ DNA Fragmentation Assay Kit (K404-60) were purchased from BioVision (USA). 4-Hydroxytamoxifen (H7904) and propidium iodide (PI) were purchased from Sigma-Aldrich (USA). Penicillin streptomycin (10,000 U/ml), Lipofectamine™ 3000, JC-1 Mitochondrial Potential Sensor (T3168) and ProLong Gold antifade reagent with DAPI (P36935) were purchased from Invitrogen (USA). Comet Assay kit (4250–050-K) was purchased from Trevigen. Annexin V-FITC Apoptosis Detection Kit (ab14085) was purchased from Abcam.

2.2. Antibodies

The peptide LKKKRQRSPFPGSPEQTK based on the protein sequence of mouse Wuho. The antibodies were purified by affinity chromatography with peptide antigens before being used for Western blot.
The following antibodies were obtained from Cell Signaling: PCNA mouse mAb (2586), p53 mouse mAb (2524), phospho-p53 (Ser15) rabbit mAb (12571), Cleaved PARP antibody (9544), Caspase-3 antibody (9662), phospho-Histone H2A.X (Ser139) rabbit mAb (9718), HP1α antibody (2616), HP1β rabbit mAb (8676), HP1γ antibody (2619), phospho-cdc2 (Tyr15) (10A11) Rabbit mAb (4539), cdc2 Antibody (77055), Cyclin B1 Antibody (4138), Caspase-9 (C9) Mouse mAb (9508). The following antibodies were obtained from EMD Millipore: Anti-GAPDH Antibody (AB2302), Anti-Cre Antibody (69050). The following antibodies were obtained from Abcam: Anti-p21 antibody (ab109199).

2.3. Mouse Wuho gene modification

Knockout of the mouse Wuho gene was carried out by the Cre-loxP system with a targeting construct to delete exons 2 and 3. The WuhoLoxP/LoxP and Wuho heterozygous (+/−) mice were generated as described in a previous report [1].
We first generated a tamoxifen-inducible Cre mouse model of WuhoLoxP/+ (WuhoLoxP/+,Cre) by crossing WuhoLoxP/LoxP C57BL/6 mice with CAGG-Cre-ER C57BL/6 mice (purchased from Jackson Lab). Following this cross, tamoxifen-inducible Cre mouse embryos of WuhoLoxP/LoxP or WuhoLoxP/− (WuhoLoxP/LoxP,Cre or WuhoLoxP/−,Cre) were generated by by crossing WuhoLoxP/+,Cre mice with WuhoLoxP/− mice.
Genotypes of mice and embryos were assessed by genomic DNA PCR using the following primers: 5′-AAGGAGGGTTTATTCTGGCTGGTCG-3′ and 5′-TCCATGGCAGCTGAGAATATTGTAG-3′ to identify the floxed allele by amplifying a 0.9 kb fragment; 5′-TGGAGCTCACGGGGGCAG GTGAGAC-3′ and 5′-TCCATGGTTATAAATCGCCATGTAG-3′ to identify the floxed allele by amplifying a 0.2 kb fragment; 5′-ACCACGAGCCTA GAGGATCAGTGGC-3′ and 5′-TCCATGGCAGCTGAGAATATTGTAG-3′ to identify the Wuho knockout allele by amplifying a 0.4 kb fragment; 5′-GCGGTCTGGCAGTAAAAACTATC-3′ and 5’-GTGAAACAGCATTGCT GTCACTT-3′ to identify the Cre allele by amplifying a 0.1 kb fragment.

2.4. MEF culture

MEFs were isolated from WuhoLoxP/+ and WuhoLoxP/−, Cre mouse embryos at 14.5 days post coitum. After the head, liver tissue and blood were removed, embryos were homogenized and typsinized at 37 °C for 30 min. Dissociated cells were resuspended in complete medium [Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 2 mM glutamine, 100 units/ml of penicillin streptomycin] at 37 °C with 5% CO2. The MEFs were trypsinized and incubated with complete medium. Cells were passaged consecutively, until a stable cell growth rate was achieved. MEFs were then cultured for an additional 15–20 passages before use in experiments.

2.5. Tamoxifen induction of Cre recombinase

We used a tamoxifen-inducible Cre-loxP system with Cre-Estrogen receptor (ER) fusion protein to delete Wuho. Cells with WuhoLoxP/LoxPCre or WuhoLoxP/−- Cre genotypes are expected to eliminate any existing copies of the Wuho gene after tamoxifen treatment. Induction of Cre recombination in MEFs was performed by adding 4-hydroxytamoxifen (TM) methanol solution to the complete medium. MEFs that were cultured in complete medium at about 70% confluence (d0) were treated with 0.1 μM TM for 3 days. The culture medium was replaced with fresh MEF medium for further incubation.
WuhoLoxP/+ MEFs were used as wild-type controls and WuhoLoxP/,Cre without TM treatment were used as Wuho heterozygous controls. Methanol was used as the 0 μM TM vehicle control. Wuho deletion was confirmed by western blot and quantitative RT-PCR.

2.6. Protein extraction and immunoblotting

Whole cell extracts were prepared with RIPA buffer (50 mM TrisHCl, pH 7.4, 1% NP-40, 0.5% Sodium deoxycholate, 0.1% SDS, 150 mM NaCl, 2 mM EDTA, 50 mM NaF). Protein concentration of the cell lysates was determined by the Bradford assay. The lysates were separated on 10% polyacrylamide gels and then transferred to PVDF membrane. The membrane was blocked for 1 h with 5% silk milk. The membrane was then incubated for overnight with primary antibodies. Detection was carried out with the appropriate horseradish peroxidase-conjugated secondary antibodies (Millipore).

2.7. Quantitative RT-PCR (qRT-PCR)

Total RNA from MEFs was extracted using TRIzol Reagent (Invitrogen), according to the manufacturer instructions. Synthesis of complementary DNA (cDNA) from total RNA was performed using SuperScript III First-Strand Synthesis System kit (Invitrogen). The firststrand cDNA served as template and was amplified with gene-specific primers for mouse Wuho (5′- CCTCTGAGGCTGTGAAGGTC -3′ and 5′AAGCGTCTGATTCTTTTCCG -3′). The relative gene expression levels were normalized to mouse GAPDH with gene-specific primers (5′-TGA TGACATCAAGAAGGTGGTGAAG-3′ and 5′-TTCTTGGAGGCCATGTAGGCCAT-3′).

2.8. RNA interference (RNAi)

Gene-specific ON-TARGET small interference RNA (siRNA) and control non-targeting pool siRNA were purchased from Dharmacon (Chicago, IL, US), and used for knockdown experiments. The sequences for all the siRNA are provided in Table 1. In brief, the WuhoLoxP/LoxP,Cre MEFs (3 × 105) were seeded in 60-mm dishes and transfected with 50 nM siRNA using Lipofectamine 3000 in medium with or without TM (0.1 μM) at day-7.

2.9. Cell proliferation assay

The MEFs were seeded in 6-well plates at a density of 5 × 104 cells/ well and treated with 0 or 0.1 μM TM for different times. Cell proliferation was assayed by live cell counting with trypan blue.

2.10. Fluorescence microscopy imaging

Cells were grown on 8-well chamber slides. Upon harvest, cells were fixed in 4% paraformaldehyde, permeabilized in 0.1% Triton X-100 and blocked with PBS containing 0.1% BSA and 0.5% tween-20. Rabbit anti γH2AX (1:400 v/v) primary antibody was applied to blocked cells. Alexa 555 anti-rabbit secondary antibody (Invitrogen) was used for fluorescence detection of γH2AX. Cells were mounted in ProLong Gold antifade reagent with DAPI (P36935, Invitrogen).

2.11. Mitochondrial membrane potential (Δψm) assay

The mitochondrial membrane potential (Δψm) was assayed by JC-1 dye. To analyze changes in the mitochondrial membrane potential, MEFs (1 × 105 cells) were grown in 6-cm dishes and treated with TM or vehicle for 7 days. The treated cells were stained for 30 mins at 37 °C in the dark with 2 μg/ml JC-1. After staining, cells were washed with PBS and detached with trypsin-EDTA solution. Cells were then transfered to a black 96-well microplate (1 × 104/well) after being washed two times with cold PBS. Healthy cells with mainly JC-1J-aggregates were detected with rhodamine detection settings (Ex/Em = 550/600 nm). Apoptotic or unhealthy cells with mainly JC-1 monomers were detected with FITC detection settings (Ex/Em = 485/535 nm) on a fluorescent microplate reader.

2.12. Cell cycle analysis

Cell cycle distribution was evaluated by flow cytometry. MEFs (1 × 105 cells) in a 60-mm dish were treated with TM for 7 days, washed twice with PBS buffer, harvested by trypsinization, and then fixed with 3 ml ice-cold 70% (v/v) ethanol at −30 °C overnight. The cell pellet was suspended in 1 ml of mixture solution (20 μg/ml PI, 200 μg/ ml RNase A, 0.1% v/v triton X-100 in PBS), incubated at room temperature in the dark room for 30 min and analyzed by flow cytometry (FACS Cablibur, Becton Dickinson, USA).

2.13. Terminal deoxynucleotidyl transferase dUTP nick end labelling (TUNEL) assay

TUNEL was performed with a commercial Apo-BrdU-Red In Situ DNA Fragmentation Assay Kit (K404-60, Biovision) according to the manufacturer’s instructions. Cell pellets were resuspended in 0.5 ml of PBS and then fixed by adding 5 ml of 4% (w/v) formaldehyde in PBS on ice for 15 min. Cells were washed in PBS and pelleted by centrifugation. Resuspended cells (0.5 ml of PBS) were transferred to 5 ml of ice-cold 70% (v/v) ethanol and chilled at −30 °C overnight. The fixed cells were then suspended in the DNA Labeling and anti-BrdU-antibody solution (K404–60, Biovision) and incubated with antibody solution in the dark for 30 min at room temperature. Analysis was conducted by flow cytometry for BrdU-Red (Ex/Em = 488/576 nm).

2.14. Annexin V assay

A characteristic of apoptosis is translocation of phosphatidylserine to the cell surface. The event was detected using an Annexin V-FITC Apoptosis Detection Kit (Cat. # ab14085, Abcam). MEFs (3 × 105 cells) in a 6-cm dish were treated with TM for 7 days. The harvested cells were washed with PBS buffer, stained with annexin V-FITC in binding buffer and analyzed by flow cytometry (FACS Cablibur, Becton Dickinson, USA).

2.15. Comet assay

Single cell DNA damage was analyzed by an alkaline comet assay using the Comet Assay kit (4250–050-K, Trevigen) according to the manufacturer’s instructions. In brief, 5 × 103 cells were suspended in Comet LM Agarose and spread on a CometSlide. Slides were placed flat at 4 °C in the dark for 40 min. The gel was treated with lysis solution (Trevigen) at 4 °C in the dark overnight, followed by electrophoresis at 300 mA for 40 min. Comet tails were stained with SYBR Gold and were observed on a fluorescent microscope (Ex/Em = 496 nm/522 nm). Quantitative measurements of tail moment were made using OpenComet v1.3 software.

2.16. Statistical analysis

Quantitative data are represented as the mean ± SEM from three independent experiments. Data were analyzed using Student’s t-test. Differences were considered statistically significant at P < 0.05.

3. Results

3.1. Tamoxifen induces Cre recombination in MEFs

Here we have created Wuho allele conditional knockout mice. The strategy used for targeting the Wuho gene is illustrated in Fig. 1A. The Wuho genomic region was replaced with one containing loxP sites after homologous recombination. Thus, the Wuho genomic region could be deleted by Cre recombinase joining the two flanking loxP sites.
Next, we bred mice to generate embryos with the genotypes, WuhoLoxP/−, Cre and WuhoLoxP/LoxP, Cre. F0 WuhoLoxP/LoxP mice were crossed with tamoxifen-inducible Cre mice in order to generate F1 progeny (WuhoLoxP/+, Cre). WuhoLoxP/LoxP, Cre mice were then crossed with WuhoLoxP/− to produce WuhoLoxP/−, Cre embryos in the F2 generation (Fig. 1B). Genomic DNA was isolated from the embryos of WuhoLoxP/+ and WuhoLoxP/−, Cre mice for PCR genotyping. The PCR products shown (Fig. 1C) represent 0.2 kb from the wild-type allele, 0.4 kb from the knockout allele, and 0.9 kb from the allele with loxP site.
TM treatment was then used to induce Cre recombination in MEFs. Optimal Cre recombination was induced by 0.1 μM TM exposure (diluted in complete medium) for 3 days. After TM exposure, cells were replenished with fresh MEF medium and incubated for the indicated number days (Fig. 1D).
We examined cell morphology, and performed western blot and qPCR analysis in MEFs at day 7 after TM treatment. In comparison with wild-type controls (WuhoLoxP/+), cell proliferation and density was decreased after TM treatment in WuhoLoxP/−,Cre MEFs. Furthermore, the cell number was significantly decreased in Wuho-depleted MEFs under phase contrast microscopy (Fig. 1E). Therefore, we conclude that Wuho deficiency inhibits cell proliferation in MEFs.
We confirmed that activation of CreER resulted in Wuho depletion in MEFs by Western bloting with an antibody to mouse Wuho. After (A) The strategy used to target the Wuho gene and create a conditional Wuho-loxP allele is shown. The Wuho genomic region can be deleted by Cre recombinase through two distal loxP sites. The symbols “ > ” and “ < ” represent the locations of forward and reverse primers used for genotyping PCR. The PCR products are 0.2 kb from the wild-type allele, 0.4 kb from the knockout allele, and 0.9 kb from the allele with loxP sites. (B) Mice breeding strategy. F0 WuhoLoxP/LoxP mice were crossed with tamoxifen-inducible Cre mice to generate F1 progeny that were WuhoLoxP/+ with Cre. WuhoLoxP/+-Cre mice were crossed with WuhoLoxP/− to produce WuhoLoxP/−-Cre embryos in the F2 generation. (C) Genomic DNA was used for WuhoLoxP/+ and WuhoLoxP/−-Cre genotyping. (D) The scheme of 4OH-tamoxifen (TM) treatment to induce Cre recombinase activity and Wuho deletion in MEFs is shown. (E) Morphology at day 7 of WuhoLoxP/+ and WuhoLoxP/−-Cre MEFs treated with 0 or 1 μM TM (Magnification: 100×). (F) Lysates from MEFs at day 7 after treatment with TM were probed anti-Wuho and Cre antibodies. Cre recombination was induced by TM, and Wuho protein expression was abolished in WuhoLoxP/−-Cre MEFs. Wuho protein level was unchanged in WuhoLoxP/+ MEFs. (G) qRT-PCR analysis of mouse Wuho expression in MEFs, normalized to GAPDH.
CreER recombination was induced by TM treatment in WuhoLoxP/−, Cre MEFs, mouse Wuho protein levels were greatly diminished. Meanwhile, Wuho protein levels were unchanged in WuhoLoxP/+ MEFs. The data suggest that TM can induce Cre recombination, resulting in Wuho deletion in WuhoLoxP/−, Cre MEFs (Fig. 1F). qPCR further showed that Wuho expression was markedly downregulated in WuhoLoxP/−, Cre MEFs after TM treatment (Fig. 1G).

3.2. Wuho deficiency leads to inhibition of cell proliferation in MEFs

We characterized the growth of WuhoLoxP/+ and WuhoLoxP/−,Cre MEFs with or without TM treatment for 1, 3, 5 and 7 days by live cell counting. As shown in Fig. 2A, the growth rate of WuhoLoxP/−, Cre MEFs was markedly slower after 5 days of TM treatment compared to WuhoLoxP/+ MEFs (control group); however, there was no significant growth difference between WuhoLoxP/+ and WuhoLoxP/−, Cre MEFs without TM treatment (Fig. 2A). The results indicate that while Wuho deficiency inhibits cell proliferation, growth is not significantly impaired in Wuho heterozygous MEFs compared to homozygous.
Time-course analysis of Wuho protein expression was performed after Wuho gene ablation. Cell protein extracts were prepared after TM treatment for different numbers of days from WuhoLoxP/+ and WuhoLoxP/−, Cre MEFs, and these extracts were examined by western blot. Mouse Wuho expression was markedly decreased in WuhoLoxP/−, Cre MEFs at day 3 after TM treatment. In addition, the DNA damage marker, γH2AX, was also detected after TM treatment. The level of phosphorylated p53 protein was slightly increased at day 3, and dramatically increased after day 5. Apoptotic markers such as cleavedcaspase-3 and cleaved-PARP were also detected at day 5. Theses result imply that DNA damage precedes apoptosis after Wuho depletion in MEFs (Fig. 2B).

3.3. Wuho deletion promotes DNA damage

In order to investigate the relationship between Wuho deficiency and DNA damage, western blots were performed for Heterochromatin protein 1 (HP1) family and γH2AX in Wuho depleted MEFs. Wuho deficiency dramatically increased the γH2AX level, which is an important (A) Wuho deletion leads to decreased cell proliferation in MEFs. Compared to WuhoLoxP/− MEFs, WuhoLoxP/−,Cre MEFs exhibited decreased cell proliferation and density after TM treatment. The cell number was significantly decreased in MEFs with Wuho deficiency. Cell growth of WuhoLoxP/+ and WuhoLoxP/−-Cre MEFs was examined by time course live cell counting. WuhoLoxP/+ and WuhoLoxP/−, Cre MEFs were treated with or without 0.1 μM TM and evaluated at d1, d3, d5 and d7. (B) Western blots show the protein levels of Cre, Wuho, γ-H2AX, phosphorylated p53 (Ser-15), cleaved caspase-3 and cleaved PARP. MEFs were seeded in a 60-mm dish until attachment (as d0), after which the cells were treated with 0.1 μM TM and evaluated at d1, d3, d5 and d7. and widely used marker for DNA DSBs. HP1 family members are versatile proteins involved in transcription, chromatin organization and replication. The western blotting results showed protein level reductions in all three HP1 isoforms, which is possibly indicative of heterochromatin relaxation to enhance DNA repair (Fig. 3A). Without TM treatment, the Wuho allele configuration did not influence γH2AX or HP1 family levels, although less Wuho protein was detected in WuhoLoxP/−, Cre cells compared to WuhoLoxP/+ cells.
Fig. 3B shows immunofluorescence staining of MEFs with indicated genotypes after TM treatment. In accordance with the western blot results, the percentage of γH2AX positive cells was markedly increased in MEFs with Wuho deletion compared to controls. The comet assay in alkaline buffer further demonstrated that Wuho depletion promotes accumulation of DNA strand breaks (Fig. 3C). Together, these results strongly suggest that Wuho depletion leads to the accumulation of DNA damage.

3.4. Wuho deficiency induces apoptosis

In order to investigate whether Wuho deficiency induces programmed cell death, Annexin V-FITC (Fig. 4A), TUNEL (Fig. 4B), and mitochondrial depolarization (Fig. 4C and D) assays were conducted. In all three assays, strong signals were detected in Wuho-depleted MEFs, clearly indicating apoptotic response and mitochondrial depolarization.
We further examined apoptosis-related cell signaling events by western blot. We observed activation of DNA damage signaling through ATM phosphorylation on Ser1981 and Chk2 on Thr68 in Wuho-depleted MEFs. Activation of caspase-mediated cell death was monitored by the cleavage of caspase-9, caspase-3 and poly (ADP-ribose) polymerase (PARP) (Fig. 4E).
To distinguish whether the elevation of γ-H2AX signal was driven by DNA damage or apoptosis, caspase-3 inhibitor, Z-DEVD-FMK, and caspase-9 inhibitor, Z-LEHD-FMK, were applied. Both inhibitors significantly suppressed PARP cleavage and rescued cell viability, but the DNA damage marker (γ-H2AX signal) was unaffected by Wuho depletion in MEFs. These results indicate that the increased level γ-H2AX in Wuho-deleted MEFs was due to DNA damage that is likely to further initiate apoptosis (Fig. 4F).

3.5. Wuho deficiency induces p21 expression and causes cell cycle G2/M phase arrest

DNA damage often induces cell cycle arrest to inhibit cell proliferation and while DNA repair is performed. To evaluate the effect of Wuho deficiency on cell cycle, WuhoLoxP/+ and WuhoLoxP/−-Cre MEFs were analyzed for cell cycle distribution 7 days after 0.1 μM TM treatment. Cellular DNA content was detected by flow cytometry. Compared to MEFs without Wuho depletion, a significant portion of Wuho-depleted cells were arrested in G2/M phase, and increased DNA fragmentation in the sub-G1 region was also observed (Fig. 5A).
We next assayed the effects of Wuho deficiency on the activation of p53 and p21 in MEFs. The results indicated the protein levels of phosphorylated p53 (Ser-15), total p53 and p21 were all increased in Wuho-depleted MEFs, while PCNA protein level was downregulated. We further measured the levels of proteins involved in G1 and G2 cell cycle checkpoints. The results showed that G1 phase regulatory (A) Western blot showing the effects of Wuho deletion on the protein levels of heterochromatin protein 1 (HP1) family members (HP1α, β, and γ) and γH2AX. (B) Western blots were quantified by densitometry. (C) Immunofluorescent staining of MEFs for γH2AX (red). Cells were counterstained with DAPI (blue) (D) Quantification of the percentage of γH2AX positive cells is shown. (E) The comet assay results and (F) quantification of comet tail moments for WuhoLoxP/+ and WuhoLoxP/−-Cre MEFs at d7 after 0 or 0.1 μM TM treatment. Data represent the mean ± SD. *P < 0.05.of the references to colour in this figure legend, the reader is referred to the web version of this article.) proteins, such as E2F1, cyclin E1 and CDK2, and G2 phase regulatory proteins, such as P-Cdc2 (Tyr-15), Cdc2 and cyclin B1 were all downregulated in Wuho-deleted MEFs (Fig. 5B).

3.6. p53 is important in apoptosis and inhibition of proliferation in Wuhodepleted MEFs

p53 is a well-known key regulator for apoptosis and proliferation inhibition. We used p53 siRNA to knockdown p53 in MEFs and assayed the cellular response to Wuho deletion. WuhoLoxP/LoxP, Cre MEFs showed reduced cell proliferation with TM treatment, but silencing p53 effectively rescued the cell number and proliferation (Fig. 6A and B). As PARP, in Wuho-deleted MEFs. Knockdown of p53 significantly downshown in Fig. 6C, p53-siRNA treatment markedly reduced p53 protein regulated the expression of phosphorylated p53 (Ser-15) and p21. level in MEFs. p53 silencing also reduced the apoptotic marker, cleaved Furthermore, p53 silencing not only rescued the Wuho knockout- induced downregulation of CDK2, Cyclin E1, CyclinB1 and Cdc2 proteins (Fig. 6B), but also reduced G2/M phase arrest and accumulation in the sub-G1 phase in Wuho depleted MEFs (Fig. 6C). Together, these data suggest that p53 signaling is involved in cell growth inhibition and apoptosis that are induced by Wuho deletion in MEFs.

4. Discussion

The gene that encodes Wuho, WDR4, maps to human chromosome 21q22.3, a region associated with several genetic disorders, such as autosomal-recessive deafness, manic-depressive psychosis and Down's syndrome. The human WDR4 gene product consists of two splice forms, one of which is mainly expressed in fetal tissues, suggesting a potential role for this variant in neural tissue development [19,20]. Previous work has shown that WDR4 encodes one of the subunits of the heterodimeric enzyme that is responsible for methylating nine human tRNAs at carbon 7 of guanosine 46 (m7G46). Functional studies have shown that the pathogenic variant of trm82, the yeast homologue of WDR4/Wuho, are responsible for diminished m7G46. WDR4/Wuho and METTL1 homologues have been identified across species, suggesting a conserved role for Trm82 and Trm8 and for the m7G46 modification in eukaryotes [21,22]. Interestingly, Shaheen et al. [23] described a mutation in the human WDR4 gene that causes primordial dwarfism. The report demonstrated direct evidence for the role of WDR4 in human disease and described the role of tRNA modifications in the molecular mechanisms of primordial dwarfism [20]. As such, mutation of the WDR4 gene, was found to correlate with reduced levels of guanosine methylation in tRNA in patients with primordial dwarfism.
tRNA modifications are known to regulate the DNA damage response, with both playing vital roles in cell cycle progression [24]. For example, Begley et al. showed that Trm9-catalyzed tRNA modifications enhance the translation of arginine and glutamic acid codons in specific gene sequences and that the levels of some DNA damage response proteins are linked to tRNA modifications [25]. Previous studies have also linked tRNA modification-dependent translation with cellular growth and survival in response to cellular stress [26]. Dewe et al. [27] suggested that loss of tRNA modifications may lead to slower progression through G2/M phase and decreased cellular proliferation. In the present study, we found that Wuho deficiency induces DNA damage and inhibits cell proliferation in MEFs. According to previous reports, we suggest that the DNA damage and cell proliferation effects we observed in Wuho-deficient MEFs may be mediated by tRNA modification defects.
Wuho has been reported to be an essential component in several developmental processes [1,2]. Embryonic lethality in mouse and infertility in fruit fly not only emphasize the importance of the gene but also highlight the practical difficulties in performing cell or animalbased experiments. Furthermore, in our study, we found that deletion of only one copy of the Wuho allele did not produce an observable phenotype. Cre-loxP-mediated recombination is a powerful gene editing tool that has become a mainstay for genetics and cell biology research. Cre-mediated recombination results in excision of floxed DNA and creation of circular, excised DNA. When the genes of interest are essential for development, inducible Cre-loxP systems may be used to execute site specific gene deletion of loci that would be highly deleterious to animals [28–30].
MEF primary culture is a widely used model for gene mutation studies. Mutant MEFs, isolated from mutant mouse lines, are valuable tools for studying the molecular and cellular mechanisms of the mutated genes in culture [18,31]. Here, we used a mouse conditional knockout system to overcome embryonic lethality that is related to Wuho deletion. To maximize knockout efficiency, WuhoLoxP/−, Cre MEFs are preferred. Our results show a robust deletion of the Wuho gene and coincident protein depletion effect after tamoxifen treatment.
Histone H2AX is an important factor in DNA damage repair, because its phosphorylation serves as a signal at DNA damage sites. The Ser139 phosphorylated form of H2AX (γH2AX) appears in response to DNA DSB formation, and γH2AX is a reliable biomarker for DNA DSBs [25,32–36]. The Heterochromatin protein 1 (HP1) family consists of three closely related isoforms, HP1α, HP1β and HP1γ, which are involved in transcription, chromatin organization and replication. Several studies have implicated HP1 proteins in the DNA damage response as well, showing that reducing the levels of all three HP1 isoforms enhances DNA repair. Reduction of HP1 proteins is expected to relax heterochromatin and bypass the requirement for ATM signaling [35,36].
In this study, we found that DNA damage is a major consequence of Wuho deficiency. DNA damage was detected by comet and γH2AX level assays, and we also found that Wuho depletion resulted in decreased levels of all three HP1 family members. The signal transducing protein, ATM, plays an important role in mediating cell cycle arrest after DNA damage, especially accumulation of DSBs [37]. In response to DNA damage, ATM phosphorylates Checkpoint kinase 2 (Chk2) at Thr68, and activated Chk2 phosphorylates downstream proteins, such as p53. Activation of p53 leads to cell cycle arrest and induction of DNA repair and/or apoptosis [38–40]. Phosphorylation of p53 is widely known to promote p21 accumulation and eventually G2/M arrest [41,42]. Based on our data, we suspect that Wuho deletion leads to DNA damage and subsequent activation of the ATM-Chk2-p53 pathway. This signaling is expected to be responsible for the initiation of apoptosis, including our observations of caspase-9 and caspase-3 cleavage.
When DNA damage occurs, ATM-Chk2 mediate cell cycle control at the G1/S and G2/M transition via p53 induction of p21 expression [43–45]. p21 is a Cip and Kip CDK inhibitor that suppresses the function of G1 cyclin/CDK complexes. p21 is induced particularly by DNA damage and functions to arrest the cell cycle, mediating the downstream effects of tumor suppressor p53 [46]. G2/M phase cell cycle arrest reduces cell proliferation and may induce apoptosis if segregation of damaged chromosomes is deficient during mitosis following genotoxic stress [47]. G2/M phase progression is promoted by cdc2 and cyclin B1. p53 and p21 can inhibit cyclin B1 and cdc2 expression by inhibiting either cdc2 kinase activity or blocking the interaction of cyclin B1/cdc2 complexes with their substrates [48–50]. In the present study, flow cytometry and proliferation assay results, in combination with G2/M regulator protein levels, suggest that G2/M arrest is mediated by activation of the p53-p21 pathway in Wuho-deleted MEFs. To confirm the central role of the p53 pathway in mediating the effects of Wuho deficiency, we used p53 siRNA to suppress its expression. Knockdown of p53 attenuated the Wuho deletion-induced upregulation of apoptotic markers, and FEN1-IN-4 reversed the downregulation of the cell cycle regulator proteins. These results clearly showed that p53 activation is essential for the cellular response to Wuho deletion.
Our work provides a new platform for cell-based studies on the multiple fuctions of mammalian Wuho. We evaluated the DNA damage and apoptotic responses after Wuho deletion using this experimental system, and our results highlight the importance of Wuho in maintaining genomic stability. However, the molecular mechanisms that mediate the effects of Wuho and other embryonic development proteins are still waiting to be explored. Importantly, our results showed that the levels of p-ATM, p-Chk2, p-p53, and p21 were upregulated after Wuho deletion, indicating that Wuho deficiency led to activation of the ATM–Chk2 and p53–p21 signaling pathways in MEFs. These cell signaling events are probably downstream of DSB accumulation. Furthermore, activation of ATM/Chk2/p53 signaling is responsible for induction of caspase-dependent programmed cell death. Overall, we found that Wuho deficiency promoted cell growth inhibition and cell cycle arrest through p53-p21 signaling in response to DNA damage.

References

[1] I.C. Cheng, B.C. Chen, H.H. Shuai, F.C. Chien, P. Chen, T.S. Hsieh, Wuho is a new member in maintaining genome stability through its interaction with flap endonuclease 1, PLoS Biol. 14 (1) (2016 Jan) e1002349.
[2] J. Wu, J.H. Hou, T.S. Hsieh, A new Drosophila gene wh (wuho) with WD40 repeats is essential for spermatogenesis and has maximal expression in hub cells, Dev. Biol.296 (1) (2006) 219–230.
[3] N. Leulliot, M. Chaillet, D. Durand, N. Ulryck, K. Blondeau, H. van Tilbeurgh, Structure of the yeast tRNA m7G methylation complex, Structure 16 (1) (2008) 52–61.
[4] H.K. Fong, J.B. Hurley, R.S. Hopkins, R. Miake-Lye, M.S. Johnson, R.F. Doolittle, et al., Repetitive segmental structure of the transducin beta subunit: homology with the CDC4 gene and identification of related mRNAs, Proc. Natl. Acad. Sci. U. S. A.83 (1986) 2162–2166.
[5] J. Michaud, J. Kudoh, A. Berry, B. Bonne-Tamir, M.D. Lalioti, C. Rossier, et al., Isolation and characterization of a human chromosome 21q22.3 gene (WDR4) and its mouse homologue that code for a WD-repeat protein, Genomics 68 (1) (2000) 71–79.
[6] E.J. Neer, C.J. Schmidt, R. Nambudripad, T.F. Smith, The ancient regulatory-protein family of WD-repeat proteins, Nature 371 (1994) 297–300.
[7] S.J. Riedl, G.S. Salvesen, The apoptosome: signalling platform of cell death, Nat.Rev. Mol. Cell Biol. 8 (5) (2007) 405–413.
[8] C.K. Chen, N.L. Chan, A.H. Wang, The many blades of the beta-propeller proteins: conserved but versatile, Trends Biochem. Sci. 36 (10) (2011) 553–561.
[9] T.F. Smith, C. Gaitatzes, K. Saxena, E.J. Neer, The WD repeat: a common architecture for diverse functions, Trends Biochem. Sci. 24 (5) (1999) 181–185.
[10] M. Saeki, Y. Irie, L. Ni, M. Yoshida, Y. Itsuki, Y. Kamisaki, Monad, a WD40 repeat protein, promotes apoptosis induced by TNF-alpha, Biochem. Biophys. Res.Commun. 342 (2) (2006) 568–572.
[11] L. Zheng, M. Zhou, Q. Chai, J. Parrish, D. Xue, S.M. Patrick, et al., Novel function of the flap endonuclease 1 complex in processing stalled DNA replication forks, EMBO Rep. 6 (1) (2005) 83–89.
[12] V. García, M. Lara-Chica, I. Cantarero, O. Sterner, M.A. Calzado, E. Muñoz, Galiellalactone induces cell cycle arrest and apoptosis through the ATM/ATR pathway in prostate cancer cells, Oncotarget 7 (4) (2016) 4490–4506.
[13] K. Ishikawa, H. Ishii, T. Saito, DNA damage-dependent cell cycle checkpoints and genomic stability, DNA Cell Biol. 25 (2006) 406–411.
[14] J. Wang, S. Huang, L. Xing, J. Cui, Z. Tian, H. Shen, et al., Sterigmatocystin induces G1 arrest in primary human esophageal epithelial cells but induces G2 arrest in immortalized cells: key mechanistic differences in these two models, Arch. Toxicol.89 (11) (2015) 2015–2025.
[15] C. Liu, Y. Zhu, W. Lou, N. Nadiminty, X. Chen, Q. Zhou, et al., Functional p53 determines docetaxel sensitivity in prostate cancer cells, Prostate 73 (2013) 418–427.
[16] S.K. Singh, S. Banerjee, E.P. Acosta, J.W. Lillard, R. Singh, Resveratrol induces cell cycle arrest and apoptosis with docetaxel in prostate cancer cells via a p53/ p21WAF1/CIP1 and p27KIP1 pathway, Oncotarget 8 (10) (2017) 17216–17228.
[17] T. Abbas, A. Dutta, p21 in cancer: intricate networks and multiple activities, Nat. Rev. Cancer 9 (2009) 400–414.
[18] A.S. Garfield, Derivation of primary mouse embryonic fibroblast (PMEF) cultures, Methods Mol. Biol. 633 (2010) 19–27.
[19] J. Michaud, J. Kudoh, A. Berry, B. Bonne-Tamir, M.D. Lalioti, C. Rossier, et al., Isolation and characterization of a human chromosome 21q22.3 gene (WDR4) and its mouse homologue that code for a WD-repeat protein, Genomics 68 (2000) 71–79.
[20] L. Filonava, A.G. Torres, L. Ribas de Pouplana, A novel cause for primordial dwarfism revealed: defective tRNA modification, Genome Biol. 16 (2015) 216.
[21] A.G. Torres, E. Batlle, L. Ribas de Pouplana, Role of tRNA modifications in human diseases, Trends Mol. Med. 20 (2014) 306–314.
[22] A. Trimouille, E. Lasseaux, P. Barat, C. Deiller, S. Drunat, C. Rooryck, et al., Further delineation of the phenotype caused by biallelic variants in the WDR4 gene, Clin.
[23] R. Shaheen, G.M.H. Abdel-Salam, M.P. Guy, R. Alomar, M.S. Abdel-Hamid, E.M. Phizicky, et al., Mutation in WDR4 impairs tRNA m7G46 methylation and causes a distinct form of microcephalic primordial dwarfism, Genome Biol. 16 (2015) 210.
[24] A. Patil, M. Dyavaiah, F. Joseph, J.P. Rooney, C.T. Chan, P.C. Dedon, et al., Increased tRNA modification and gene-specific codon usage regulate cell cycle progression during the DNA damage response, Cell Cycle 11 (19) (2012) 3656–3665.
[25] U. Begley, M. Dyavaiah, A. Patil, J.P. Rooney, D. DiRenzo, C.M. Young, et al., Trm9catalyzed tRNA modifications link translation to the DNA damage response, Mol.
[26] D.D. Nedialkova, S.A. Leidel, Optimizationofcodontranslationrates via tRNA modifications maintains proteome integrity, Cell 161 (2015) 1606–1618.
[27] J.M. Dewe, B.L. Fuller, J.M. Lentini, S.M. Kellner, D. Joshua M. Dewea Fu, Benjamin L. Fullera, Jenna M. Lentinia, Stefanie M. Kellnerb, Fu Dragony, TRMT1-catalyzed tRNA modifications are required for redox homeostasis to ensure proper cellular proliferation and oxidative stress survival, Mol. Cell. Biol. 31 (2017) e00214-00217. [28] M.A. McLellan, N.A. Rosenthal, A.R. Pinto, Cre-loxP-mediated recombination: general principles and experimental considerations, Curr. Protoc. Mouse Biol. 7 (1) (2017) 1–12.
[29] B. Sauer, N. Henderson, Site-specific DNA recombination in mammalian cells by the Cre recombinase of bacteriophage P1, Genetics 85 (1988) 5166–5170.
[30] B. Hall, A. Limaye, A.B. Kulkarni, Overview: generation of gene knockout mice, Curr. Protoc. Cell Biol. 44 (2009) 1–17.
[31] J. Xu, Preparation, culture, and immortalization of mouse embryonic fibroblasts, Curr. Protocols in Mol. Biol. (Suppl. 70) (2005) 28.1.1–28.1.8.
[32] L.J. Kuo, L.X. Yang, γ-h2ax-a novel biomarker for dna double-strand breaks, In Vivo. 22 (3) (2008) 305–309.
[33] M. Podhorecka, A. Skladanowski, P. Bozko, H2AX phosphorylation: its role in DNA damage response and cancer therapy, J. Nucleic Acids (2010), http://dx.doi.org/ 10.4061/2010/920161.
[34] C.E. Redon, A.J. Nakamura, O.A. Martin, P.R. Parekh, U.S. Weyemi, W.M. Bonner, Recent developments in the use of γ-H2AX as a quantitative DNA double-strand break biomarker, Aging (Albany NY) 3 (2) (2011) 168–174.
[35] A.A. Goodarzi, A.T. Noon, D. Deckbar, Y. Ziv, Y. Shiloh, M. Lobrich, et al., ATM signaling facilitates repair of DNA double-strand breaks associated with heterochromatin, Mol. Cell 31 (2008) 167–177.
[36] C. Dinant, M.S. Luijsterburg, The emerging role of HP1 in the DNA damage response, Mol. Cell. Biol. 29 (24) (2009) 6335–6340.
[37] J. Bartkova, N. Rezaei, M. Liontos, P. Karakaidos, D. Kletsas, N. Issaeva, et al., Oncogene-induced senescence is part of the tumorigenesis barrier imposed by DNA damage checkpoints, Nature 444 (2006) 633–637.
[38] Y. Miyasaka, E. Nagai, H. Yamaguchi, K. Fujii, T. Inoue, K. Ohuchida, et al., The role of the DNA damage checkpoint pathway in intraductal papillary mucinous neoplasms of the pancreas, Clin. Cancer Res. 13 (2007) 4371–4377.
[39] M.F. Lavin, S. Kozlov, ATM activation and DNA damage response, Cell Cycle 6 (2007) 931–942.
[40] A. Sancar, L.A. Lindsey-Boltz, K. Unsal-Kacmaz, S. Linn, Molecular mechanisms of mammalian DNA repair and the DNA damage checkpoints, Annu. Rev. Biochem. 73 (2004) 39–85.
[41] Hirao A1, Y.Y. Kong, S. Matsuoka, A. Wakeham, J. Ruland, H. Yoshida, et al., DNA damage-induced activation of p 53 by the checkpoint kinase Chk 2, Science 287 (2000) 1824–1827.
[42] L. Zannini, D. Delia, G. Buscemi, CHK2 kinase in the DNA damage response and beyond, J. Mol. Cell Biol. 6 (6) (2014) 442–457.
[43] J. Bartek, J. Lukas, Chk1 and Chk2 kinases in checkpoint control and cancer, Cancer Cell 3 (2003) 421–429.
[44] Y. Shiloh, ATM and related protein kinases: safeguarding genome integrity, Nat.
[45] H.F. Horn, K.H. Vousden, Coping with stress: multiple ways to activate p53, Oncogene 26 (2007) 1306–1316.
[46] K.A. Manu, T.F. Chai, J.T. Teh, W.L. Zhu, P.J. Casey, M. Wang, Inhibition of Isoprenylcysteine Carboxylmethyltransferase induces cell-cycle arrest and apoptosis through p21 and p21-regulated BNIP3 induction in pancreatic Cancer, Mol. Cancer Ther. 16 (5) (2017) 914–923.
[47] X.H. Zhang, Zou Zq, C.W. Xu, Y.Z. Shen, D. Li, Myricetin induces G2/M phase arrest in HepG2 cells by inhibiting the activity of the cyclin B/cdc2 complex, Mol. Med. Rep. 4 (2011) 273–277.
[48] C. Lv, W. Sun, H. Sun, S. Wei, R. Chen, B. Wang, C. Huang, Asperolide A, a marinederived tetranorditerpenoid, induces G2/M arrest in human NCI-H460 lung carcinoma cells, is mediated by p53-p21 stabilization and modulated by Ras/Raf/MEK/ ERK signaling pathway, Mar. Drugs 11 (2) (2013) 316–331.
[49] X. Yin, R. Zhang, C. Feng, J. Zhang, D. Liu, K. Xu, X. Wang, S. Zhang, Z. Li, X. Liu, H. Ma, Diallyl disulfide induces G2/M arrest and promotes apoptosis through the p53/p21 and MEK-ERK pathways in human esophageal squamous cell carcinoma, Oncol. Rep. 32 (4) (2014) 1748–1756.
[50] Z. Zhang, C.Z. Wang, G.J. Du, L.W. Qi, T. Calway, T.C. He, et al., Genistein induces G2/M cell cycle arrest and apoptosis via ATM/p53-dependent pathway in human colon cancer cells, Int. J. Oncol. 43 (2013) 289–296.