Nerve growth factor prevents arsenic‐induced toxicity in PC12 cells through the AKT/GSK‐3β/NFAT pathway

Zhen Tan | Ting Kang | Xiuli Zhang | Yingying Tong | Siyu Chen

Abstract

The potential risk of arsenic‐related neurodegeneration has been a growing concern. Arsenic exposure has been reported to disrupt neurite growth and neuron body integrity in vitro; however, its underlying mechanism remains unclear. Previously, we showed that arsenic sulfide (AS) exerted cytotoxicity in gastric and colon cancer cells through regulating nuclear factor of the activated T cells (NFAT) pathway. The NFAT pathway regulates axon path finding and neural development. Using neural crest cell line PC12 cells as a model, here we show that AS caused mitochondrial membrane potential collapse, reactive oxygen species production, and cytochrome c release, leading to mitochondria‐mediated apoptosis via the AKT/GSK‐3β/NFAT pathway.
Increased glycogen synthase kinase‐3 beta (GSK‐3β) activation leads to the inactivation of NFAT and its antiapoptotic effects. Through inhibiting GSK‐3β activity, both nerve growth factor (NGF) and Tideglusib, a GSK‐3β inhibitor partially rescued the PC12 cells from the AS‐induced cytotoxicity and restored the expression of NFATc3. In addition, overexpression of NFATc3 stimulated neurite outgrowth and potentiated the effect of NGF on promoting the neurite outgrowth. Collectively, our results show that NFATc3 serves as the downstream target of NGF and plays a key role in preventing AS‐induced neurotoxicity through regulating the AKT/GSK‐3β/NFAT pathway in PC12 cells.

KEYW ORD S
arsenic sulfide, glycogen synthase kinase‐3 beta (GSK‐3β), nerve growth factor (NGF), nuclear factor of activated T cells (NFAT), PC12

1 | INTRODUCTION

Chronic exposure to arsenic is a pervasive environmental health problem that threatens the vulnerable populations (Hsu et al., 2017). Exposure to elevated levels of arsenic is toxic to the nervous system (Y. Zhang et al., 2016): acute exposure to arsenic at high levels can result in mild, but persistent peripheral neuropathy in humans (Sinczuk‐Walczak, Szymczak, & Halatek, 2010), while chronic exposure can result in sensory deficits and impairment of higher neurological function (Mochizuki et al., 2016). Previous in vitro studies using the differentiating neuronal cells have shown that arsenic exposure can result in altered cellular morphology (Frankel et al., 2009) and impair the function of neurons (Takatoh, Prevosto, & Wang, 2018). The development of dendrites and axons is essential for subsequent neuron function and connectivity (Klingseisen & Lyons, 2018).
Arsenic sulfide (AS), an inorganic mineral found around hot springs and sulfur volcanoes, is also the main component of traditional Chinese medicine realgar (L. Zhang et al., 2015). We previously reported that AS inhibited the proliferation of gastro- intestinal cancer cells by regulating the NFAT pathway (Ding, Tong, Zhang, Pan, & Chen, 2016; X. Zhang et al., 2017). NFAT was first identified as a transcription factor binding to the interleukin‐2 promoter in human T cells (Durand et al., 1988; Shaw et al., 2010).
There are four classic NFAT isoforms including NFATc1, NFATc2, NFATc3, and NFATc4 (Ho et al., 1995; Ranger et al., 2000; Yang, Davis, & Chow, 2001; Zhou, Sun, Dotsch, Wagner, & Verdine, 1998) that have been shown to play important roles in many vertebrate developmental systems, including axon growth, synaptic plasticity, and neuronal survival (Graef, Chen, & Crabtree, 2001; Kao et al., 2009; Rojanathammanee, Floden, Manocha, & Combs, 2015). NFATs translocate from cytosol to the nucleus and regulate their target genes upon activation by the calcium‐dependent phosphatase calcineurin (Graef et al., 2003; Kipanyula, Kimaro, & Seke Etet, 2016). NFATc1 promotes the synaptic reconstruction of neurons and glial cells and facilitates improvements in neurological function (Wu et al., 2016). Removal of NFATc2, c3, and c4 results in sensory neuron axon projection defects in vivo (Graef et al., 2001), suggesting that axon growth during development requires NFAT signaling. NFATc3 inhibits the proliferation of neural precursor cells, while stimulating their migration and differentiation into astrocytes and neurons (Serrano‐Perez et al., 2015). NFATc4 promotes the survival of granule cells in the developing cerebellum (Benedito et al., 2005) and affects neuronal excitability (Yao, Zhao, Liu, Chow, & Mei, 2016).
In the nucleus, the conserved serine residues located in the N‐terminal domain of NFAT are phosphorylated by GSK‐3β, which promotes NFAT nuclear exports and consequently terminates the transcriptional actions of NFAT (Hardt & Sadoshima, 2004). In the neurons, GSK‐3β contributes to the control of neuronal transmission and plasticity (Kaidanovich‐Beilin & Woodgett, 2011). In addition, accumulating evidence has suggested that GSK‐3 signaling pathway is involved in the regulation of different aspects of neural development (Ahn et al., 2014; W. Y. Kim et al., 2009). As a downstream target of PI3K/AKT, GSK‐3β regulates both the nuclear residence and the activity of NFAT (Beals, Sheridan, Turck, Gardner, & Crabtree, 1997).
Recent data showed that NFAT and NFAT‐dependent functions in neurons could also be regulated by NGF and other neurotrophins. NFAT is essential for NGF‐dependent axonal growth, and deletion of NFAT isoforms NFATc2, NFATc3, and NFATc4 disrupts neurite outgrowth (Graef et al., 2003). Moreover, the facilitatory effect of NGF partly depends on the inhibition of GSK‐3β (M. S. Kim et al., 2014). Despite the growing evidence that NFAT proteins are important effectors of neurotrophin signaling, the mechanisms of NFAT regulation by neurotrophins are not well understood.
In this study, we investigated the effects of inorganic arsenic exposure on the formation and outgrowth of neurites in differen- tiated PC12 cells to elucidate its molecular mechanism. Our previous study showed that AS regulated NFATs via the promyelocytic leukemia and p53 pathways in solid tumor cells (Ding et al., 2016). Here we show that AS exposure in the low micromolar range resulted in characteristic alterations in the morphology of PC12 cells including reduced outgrowth and branching of neuritis with increased thickness Both GSK‐3β inhibitor Tideglusib, and NGF prevented the arsenic toxicity by restoring the expression of NFATc3 in PC12 cells. Our data suggest that NGF attenuates AS‐induced cytotoxicity by inhibiting the AKT/GSK‐3β/NFAT signaling and that NFATc3 serves as a downstream target of NGF in regulating neuronal neutrite outgrowth.

2 | MATERIAL AND METHODS

2.1 | Cell culture and reagents

PC12 cells were obtained from the Chinese Academy of Sciences Committee Type Culture Collection cell bank (China). PC12 cells were grown in DMEM media (Hyclone, USA) at 37°C and 5% CO2, supplemented with 10% fetal bovine serum (Gibco, USA). Highly purified AS was supplied by the Shanghai Institute of Hematology (Shanghai, China) and was prepared as previously described (L. Zhang et al., 2015). The stock solution of AS (133.36 μM) was diluted in complete culture medium to obtain working solutions. 3‐(4,5‐dimethylthiazlo‐2‐yl)‐2,5‐diphenyltetrazolium bromide (MTT) was purchased from Sigma–Aldrich (St. Louis, MO). Antibodies for NFATc1, NFATc2, NFATc3 and NFATc4 were purchased from Sigma‐Aldrich (St. Louis, MO), Santa Cruz Biotechnology (Santa Cruz, CA), and Abcam (Cambridge, MA), respectively. Antibody for p‐gsk3β, gsk3β, Bax, Bcl‐2, p53, c‐Myc was from Cell Signaling Technology (Beverly, MA). Antibody for AKT1, p‐AKT1, cytochrome C, COX IV, Caspase‐3 and cleaved Caspase‐3 was from Abclonal (Wuhan, China) while anti‐β‐actin was obtained from Proteintech Group (Wuhan, China). Brain‐derived growth factor, PEPTECH (Hangzhou, China); Forskolin, Beyotime (Wuhan, China); LiCl, Sangon Biotech (Shanghai, China); cyclosporine A (CsA), Sigma–Aldrich (St. Louis, MO).

2.2 | Analysis of cell viability

The cell viability was measured by MTT assay. PC12 cells (5 × 103 cells/well, 90 μl) were seeded into 96‐well plates and allowed to attach. The cells were exposed to different concentration of AS (0, 2.5, 5, 10, 15, 20, 50 μM) for 24, 48 or 72 hr. After incubation with AS, 10 μl MTT (5 mg/ml) was added to each well to replace the original solution for 4 hr at 37℃. Thereafter, 150 μl sodium dodecyl sulfate was added to each well and incubated at 37℃ overnight. The absorbance at 562 nm was measured using a microplate reader (Bio‐TEK). Cells incubated without any treatment were used as a control. Culture medium without cells was used as blank control. Each sample was assayed in quadruples. It was denoted that the percentage cell viability = (average OD of the experimental group − average OD of blank control group/average OD of control group – average OD of the blank control group) × 100%.

2.3 | Photography of PC12 cells after AS treatment

PC12 cells were seeded at a density of 1.25 × 104 cells/ml in 12‐well plates (Becton Dickinson, Franklin Lakes, NJ) for 24 hr. After 24 hr, the cells were exposed to 0, 5, 10, 15 or 20 μM AS. The treated cells were imaged at 24, 48, and 72 hr after AS incubation using a microscope (DMI 3000B; Leica Microsystems, Wetzlar, Germany).

2.4 | Immunofluorescence assay

4′,6‐Diamidino‐2‐phenylindole (DAPI) staining was used to observe the morphology changes of the nuclei of PC12 cells treated with AS. The cells were seeded on coverslips in six‐well plates for 24‐hr AS treatment. After incubation, the PC12 cells were fixed with 4% paraformaldehyde for 20 min, and the 4% PFA was removed and each sample with was covered with DAPI staining solution (Beyotime Institute of Biotechnology, Haimen, Jiangsu, China) according to the manufacturerʼs protocol. DAPI‐stained cell morphology was observed under a fluorescent microscope (DMI 3000B; Leica Microsystems, Wetzlar, Germany).

2.5 | Hematoxylin and eosin staining

Morphological changes of neuron bodies and axons after AS treatment were observed through the hematoxylin & eosin (HE) staining. PC12 cells, seeded on coverslips in six‐well plates, were fixed with 4% paraformaldehyde for 20 min after 24‐hr AS treatment. Then, they were subject to hematoxylin for 15 min and eosin solution for 5 min according to the manufacturerʼs protocol. HE‐stained cell morphology was observed under a fluorescence microscope (DMI 3000B; Leica Microsystems, Wetzlar, Germany).

2.6 | Western blot analysis

Cell lysates were extracted using enhanced RIPA Lysis Buffer (Beyotime, Wuhan, China) containing 1% dilution of the phenyl- methanesulfonyl fluoride (Beyotime, Wuhan, China). Protein concentrations were determined using a microplate reader (Bio‐TEK, USA) with the enhanced BCA Protein Assay kit (Beyotime, Wuhan, China). Equal amounts of protein in each lane were separated by 8% to 10% sodium dodecyl sulfate‐polyacrylamide gel electrophoresis and transferred to a 0.45 μm polyvinylidene fluoride membrane (Millipore, Billerica, MA). After blocking the membrane in 5% nonfat milk, the membrane was incubated with primary antibodies at 4°C overnight, followed by incubating with labeled secondary antibody at room temperature for 1 hr, washed, added Immobilon Western Chemilum HRP Substrate (Millipore, Billerica, MA) and images were acquired using GelDoc XR System (Bio‐Rad, USA).

2.7 | Flow cytometry analysis of apoptosis

After the corresponding treatments for 24 hr, 5 × 105–1× 106 cells were collected by centrifugation. The cells were suspended with cold phosphate‐buffered saline and the supernatant was discarded after centrifugation at 1,000 rpm for 10 min at 4℃ twice. The cells were further stained with FITC‐Annexin V (5 μg/ml) and PI (5 μg/ml) at 4°C for 30 min, which were then subjected to flow cytometry analysis with a BD flow cytometer (BD Biosciences, USA). Cells with Annexin V positive were labeled as apoptotic cells.

2.8 | Flow cytometry analysis of reactive oxygen species

To measure the cellular reactive oxygen species (ROS) levels, the cells were incubated with 2′,7′‐dichlorofluorescein‐diacetate (DCFH‐DA; Beyotime, Wuhan, China) in the dark for 30 min at 37°C. After washing, the cells were analyzed by flow cytometry, using the FACS Calibur flow cytometer (BD Biosciences, USA). Data were analyzed using the FCSExpress V3 program (DeNovo Software, Los Angeles, CA).

2.9 | Flow cytometry analysis of mitochondrial potential

Cells were treated and resuspended in serum‐free medium at a concentration of 1 million cells/ml. To each sample was added 5 μl of JC‐1 dye (200 μM; Beyotime, Wuhan, China) for incubation at 37°C, 30 min. The samples were measured by flow cytometry, with 10,000 events collected and analyzed using the FCSExpress V3 program (DeNovo Software).

2.10 | pMAX‐clover‐NFATc3 plasmid construction and transfection

The pMAX‐clover‐NFATc3 vector for overexpression of NFATc3 was constructed by PCR amplification of the primary NFATc3 sequence (3,228 bp) from human cDNA using the primers as follows. NFATc3 Forward AGAATTCATGACTACTGCAAACTGTGG NFATc3 Reverse GCGTCGACTTAGAGCCCATCAGATCTTC The cloning of this sequence downstream of the clover sequence in the pMAXclover vector uses the EcoRI/SalI sites. PC12 cells were grown in six‐well culture plates and then transfected with pMAX‐ clover‐NFATc3 using Lipofectamine 2000 (Invitrogen, California, CA) according to the manufacturerʼs instructions. Briefly, Lipofectamine 2000 and pMAX‐clover‐NFATc3 were diluted in opti‐MEM medium, incubated for 5 min, mixed together, and then incubated for 30 min at room temperature and added to the PC12 cell cultures. The transfection efficiency was observed by fluorescence microscopy on the basis of GFP expression and further confirmed by measuring protein levels of NFATc3.

2.11 | Infection with shRNA‐encoding lentivirus

Lentiviruses (pHBLV‐U6‐Zsgreen) encoding NFATc3 shRNA (shNFATc3) were provided by HanBio (Shanghai, China). PC12 cells were grown to 30%–40% confluence in six‐well culture plates and then infected with lentivirus encoding shRNA according to the manufacturerʼs instructions. In brief, 5 μl polybrene was added to each well and incubated at 37°C for 30 min, followed by addition of required amounts lentivirus according to the multiplicity of infection of specific cells. Infection efficiency was observed by fluorescence microscopy on the basis of GFP expression, and further confirmed by measuring protein levels of NFATc3. After 12 hr incubation at 37°C, the cells were washed and incubated with fresh medium for an additional 60 hr before analysis; culture medium was replaced daily. The shRNA sequences were the same as those previously used.

2.12 | Statistical analysis

All data were presented as the mean standard deviation. Data analysis was performed using one‐way analysis of variance, followed by either the least significant difference procedure (when the variance was equal) or the Games–Howell procedure (when the variance was unequal). Tukeyʼs post hoc test was used for multiple group comparisons and Student t test was used for single comparisons. A two‐sided p < 0.05 was considered statistically significant. Statistical analysis was performed using SPSS software version 19.0 (IBM Corporation, Armonk, NY).

3 | RESULTS

3.1 | AS decreases the viability of PC12 cells

Low micromole sodium arsenite (0.5–5.0 μM) disrupted neurite growth and complexity (Frankel et al., 2009). Considering that the different cytotoxicity between AS and sodium arsenate, we expanded the drug concentration range. Therefore, here we treated PC12 cells with various concentrations of AS (0, 2.5, 5, 10, 15, 20, and 50 μM) for 24, 48, or 72 hr. AS inhibited the proliferation of PC12 cells in a time‐ and dose‐dependent manner. In addition, the 24, 48, and 72 hr IC50 values for PC12 cells were 26.8 μM, 18.7 μM, and 12.6 μM, respectively (Figure 1a).
The apoptosis rate in AS‐treated PC12 cells was assessed by flow cytometry using annexin V‐FITC/PI staining. After incubation for 24 hr, 15.8% of the cells treated with 5 μM AS reached the apoptotic phase (annexin V‐positive staining; p ≤ 0.01). With AS at 10,15 and 20 μM, we observed the apoptosis rate at 25.9%, 51.4%, and 70.2% respectively, indicating that the AS‐induced cytotoxicity was dose‐ dependent (p ≤ 0.01) (Figure 1b).
To further assess the morphological changes induced by AS, PC12 cells were stained with DAPI and observed under a fluorescence microscope. PC12 cells were treated with different concentration of AS as indicated for 24 hr. The cells treated with AS showed nuclear chromatin condensation to the edge similar to the morphological changes observed in cells undergoing apoptosis, while cells in the control group maintained intact and normal nuclei. Furthermore, PC12 cells treated with increasing concentration of AS entered into the advanced phases of degradation, with disassembled and fragmented nuclei (Figure 1c).

3.2 | The mitochondrial pathway is involved in AS induced apoptosis in PC12 cells

AS increased ROS production in PC12 cells, as indicated by DCFH‐DA flow cytometry. Compared with the control,of 9.8%, the DCFH‐DA‐ positive cells increased to 15.6%, 32.5%, 52.4% and 56.8% respectively at the AS concentration of 5,10,15 and 20 μM, indicating that ROS production induced by AS was dose‐dependent (p ≤ 0.01; Figure 2a). The overproduction of ROS causes dysfunction of mitochondria, leading to the loss of the mitochondrial membrane potential (MMP). We detected the MMP of PC12 cells using flow cytometry with a JC‐1 probe. As indicated in Figure 2b, the MMP of the cells treated with a high dose of AS decreased significantly. Compared with the control (8.8%), AS at the 10,15, and 20 μM caused MMP loss by 22.6%, 46.6%, and 63.2%, respectively. Meanwhile, calcineurin/NFAT inhibitor CsA inhibited the AS‐induced cell death by blocking the mitochondrial permeability transition pore (mPTP) opening and by maintaining the MMP (Supporting Information Figure S1), indicating that AS might induce mitochondrial damage through the mPTP‐ related mechanism.
The elevated permeability of the mitochondrial outer membrane facilitates the leakage of cytochrome c from the dysfunctional mitochondria into the cytoplasm, activating the caspase cascade, which is a central component in the execution of apoptosis. We found that the level of cleaved caspase‐3 increased markedly after the AS treatment, accompanied by the decreased protein level of pro‐caspase‐3. AS‐induced apoptosis is also regulated by p53 in solid tumor cells (Ding et al., 2016). We found that expression of P53 was downregulated after the treatment with AS. The proapoptotic protein Bax is one of the critical downstream mediators in the p53 signaling pathways. The protein level of Bax was increased, while the protein level of Bcl‐2 was reduced significantly when the cells were treated with AS. AS treatment suppressed the protein level of c‐Myc as well in PC12 cells (Figure 2c).

3.3 | AS exerts time and dose‐dependent inhibition on axonal outgrowth in PC12 cells

The morphological complexity of mature neurons is critical to their physiologic function. Exposure to AS from 5 to 20 μM for 24, 48, and 72 hr resulted in a clear reduction in neurite outgrowth and complexity in a time‐ and dose‐dependent manner. With the increased dose of AS and the prolongation of treatment time, the cell body area increased in AS‐exposed cells, while the number of primary neurites decreased. However, in AS exposed cultures there was a trend for cell body area to be greater than in control cultures. The neurites exposed to AS were not only shorter but also wider compared to the control (Figure 3a). HE staining was used to observe the morphological changes of neuron bodies and axons after AS treatment. Consistent with the 72 hr continuous microscope photography, the cell body volume of the neurons increased, and the axons became shorter and thicker after AS incubation in a dose‐dependent manner (Figure 3b).

3.4 | Inhibition of AKT/GSK‐3β/NFAT axis is involved in AS‐induced cytotoxicity in PC12 cells

NFAT proteins promote the synaptic reconstruction of neurons and facilitate improvements in neurological function. As exposure to AS impaired the neurite outgrowth and the morphologic complexity of PC12 cells, we looked at the effect of AS on the expression of NFAT proteins in PC12 cells. PC12 cells were treated with different concentrations of AS from 5 μM to 20 μM for 24 hr for immunoblot analysis. We found that AS inhibited the expression of NFATc1, NFATc2, NFATc3, and NFATc4 (Figure 4a); the inhibition was apparent on NFATc1 and NFATc4 with 10 μM and nearly complete with 20 μM, while the inhibition on NFATc2 and NFATc3 was apparent with 15 μM. All the inhibitions on NFATc1, NFATc2, NFATc3, and NFATc4 were dose‐dependent. Surprisingly, AS inhibits the expression of NFATc2, unlike its upregulation of NFATc2 expression in HCT116 cells (Ding et al., 2016). This may be related to the fact that the p53 was mutated in PC12 cells while HCT116 cells contain the wild‐type p53. We also treated PC12 cells with 20 μM AS from 2 to 24 hr to observe the effect of different incubation time. The inhibition on NFATc1, NFATc3, and NFATc4 was apparent after 6 hr of AS treatment, and for NFATc2 the stimulation was evident after 2 hr of AS treatment (Figure 4b). These results indicated that AS exerted differential effects on the expression of the four classic NFAT proteins.
As a downstream target of PI3K/AKT, GSK‐3β regulates both the nuclear residence and the activity of NFAT. We, therefore, examined the effects of AS on GSK‐3β activity by evaluating its phosphorylation at Ser9. Phosphorylation of Ser9 inhibits the GSK3β enzymatic activity. The PC12 cells treated with AS showed decreased phosphorylation of Ser9 (Figure 4c). To further identify the effects of AS on GSK‐3β activation, we also looked at the changes of AKT1 phosphorylation at the site Ser473. AKT1 is the upstream regulator of GSK‐3β. We found that the phosphorylation of Ser473 in AKT1 was decreased upon AS treatment (Figure 4d). The activity of p‐AKT1 was reduced accordingly and was accompanied by the activation of GSK‐3β.

3.5 | NGF and Tideglusib alleviate AS‐induced mitochondrial‐mediated apoptosis in PC12 cells

We investigated if NGF and Tideglusib exerted a protective effect on PC12 cells treated with AS. As indicated in Figure 5a, the viability in AS‐treated PC12 cells was 59.2% compared with 83% in the PC12 cells treated with both AS and NGF (100 ng/ml) and 83% in the PC12 cells treated with both AS and Tideglusib. The protective effects of NGF (50 or 100 ng/ml) and Tideglusib (1 nM or 5 nM) were further confirmed with flow cytometry. Both NGF and Tideglusib effectively prevented AS‐induced cell death. NGF significantly reduced the rate of apoptosis from 35% to 9.6%, while Tideglusib (1 nM or 5 nM) reduced the rate of apoptosis to 13% and 8.5%, respectively (Figure 5b).
Apoptotic events disrupt electron transport in the mitochon- dria, leading to the MMP collapse, facilitating the leakage of cytochrome c from the dysfunctional mitochondria into the cytoplasm. We further examined whether pretreatment with NGF or Tideglusib could restore the AS‐induced MMP loss. As indicated in Figure 5c, 20 μM AS caused 63.2% MMP loss. When co‐incubated with AS and NGF, the MMP loss dropped to 41.5% (NGF 50 ng/ml) and 22.7% (NGF 100 ng/ml), respectively. Mean- while, Tideglusib (1 nM or 5 nM) also exerted a significant protective effect on mitochondria and reduced the MMP loss to 30.2% and 12.6%, respectively.
Mitochondrial damage is always accompanied with the release of cytochrome c, which triggers caspase activation, and eventually leads to apoptosis. To further confirm the effects of NGF and Tideglusib on mitochondrial protection, we performed mitochondria fractionation assays to examine the release of cytochrome c after AS treatment in the presence or absence of NGF and Tideglusib in PC12 cells. We observed that the protein level of cytochrome c was markedly increased in the cytosolic fraction of cells treated with AS, accompanied by a reduction of their levels in the membrane‐fraction, as determined by western blot analysis (Figure 5d,e). As indicated, both NGF and Tideglusib significantly blocked AS‐induced cyto- chrome c release from the mitochondria to the cytosol. The protein level of cytochrome c in the mitochondria was partially restored in cells treated with both NGF or Tideglusib compared with the AS‐ treated ones. The protein level of cytochrome c in the cytosolic fraction in AS‐treated cells was significantly lower when treated with NGF or Tideglusib. These data indicated that GSK‐3β inhibitor, including NGF and Tideglusib, antagonized AS‐induced cytotoxicity in PC12 cells, suggesting that GSK‐3β plays a key role in arsenic toxicity.

3.6 | NGF rescued PC12 cells from AS‐induced toxicity via regulating NFATc3

Both GSK‐3β inhibitor Tideglusib and NGF alleviated AS‐induced cytotoxicity. We found that pretreatment with NGF significantly inhibited GSK‐3β activation mediated by AS (Figure 6a). Compared with the AS treated cells, the protein level of p‐GSK‐3β treated with both AS and NGF was increased significantly. Moreover, NGF and Tideglusib also partially restored the NFATc3 expression that was suppressed by AS (Figure 6a,b), suggesting that NFATc3 could be the downstream target of NGF. NFATc3 also regulates the expression of other NFAT family members. Knockdown of NFATc3 suppressed the expression of NFATc1 and NFATc4, while over‐expression of NFATc3 had opposite effects (X. Zhang et al., 2017). We hence overexpressed NFATc3 in PC12 cells to determine whether it stimulates neurite outgrowth and potentiates the effect of NGF. As showed in Figure 6c, the average cell body area increased, while the number of primary neurites decreased in the cells treated with AS. Also, the cell body area became larger while neurites became shorter and wider than that of the control. When cells were co‐treated with NGF (50 or 100 ng/ml), the cell body volume was smaller, and neurites became longer and thinner compared with the AS group.
When cells were co‐treated with AS and JQ1 (10 μM), neurites became even shorter and wider than the AS group. We then overexpressed NFATc3 in PC12 cells and found that it can stimulate neurite outgrowth and potentiate the effect of NGF. NFATc3 overexpression in PC12 cells reduced arsenic toxicity and partly restored the original cell morphology compared with the AS‐treated group. Collectively, these results suggest NFATc3 stimulates the neurite outgrowth and serves as the downstream target of NGF.
AS activates the activity of GSK‐3β, which in turns regulates NFAT by phosphorylation. We asked if NFATc3 reciprocally regulated GSK‐3β activity. We found that overexpression of NFATc3 decreased the phosphorylation of Ser9 in GSK3β (Figure 7a), while knockdown of NFATc3 increased the phosphorylation of Ser9 on GSK‐3β (Figure 7b), suggesting NFATc3 and GSK‐3β indeed reciprocally regulate each other.

4 | DISCUSSION

Low micromolar levels of sodium arsenite pose neurotoxicity to newly differentiating PC12 cells by reducing neurite production, outgrowth, and complexity (Frankel et al., 2009), with the under- lying mechanism unknown. Here, we found that AS disrupted the growth of differentiated PC12 cells and induced mitochondria‐ mediated apoptosis via the AKT/GSK‐3β/NFAT pathway. AS caused ROS production, a mitochondrial oxidative stress, which in turn decreases the MMP. The impaired MMP prompted the leakage of cytochrome c and activation of the caspase cascade and hence apoptosis.
It has been reported that mitochondrial oxidative stress activates GSK‐3β, leading to the opening of mPTP and the initiation of mitochondria‐mediated apoptosis. GSK‐3β is one of the first NFAT kinases to have been identified and is known to regulate the nuclear export of all of the canonical NFAT isoforms (NFATc1–4; Arron et al., 2006; Graef et al., 1999). Recent studies revealed that GSK‐3β suppressed NFAT‐mediated gene expression in neurons (Gomez‐ Sintes & Lucas, 2010; Graef et al., 1999). GSK‐3β is also associated with various neurodegenerative diseases including Alzheimerʼs disease and Parkinsonʼs disease, while the inhibition of GSK‐3β protects neurons from neuronal toxicity. Here, we demonstrate that NGF protected PC12 cells from AS‐induced cell apoptosis via modulating GSK‐3β‐NFAT signaling. Through inhibition of GSK‐3β, both NGF and Tideglusib blocked oxidative stress‐induced PTP opening, decreased cytochrome c release and thus antagonized the arsenite cytotoxicity. GSK‐3β acts as the downstream target of PI3K/AKT signaling and is negatively regulated by AKT1.
Moreover, GSK‐3β activation leads to inactivation of NFAT, further decreasing its antiapoptotic effects. Classic NFAT proteins are activated through dephosphorylation by serine/threonine phos- phatase calcineurin to unmask their nuclear localization signal sequence leading to nuclear import. The sensory and commissural neurons lacking calcineurin function or NFATc2, c3, and c4 are unable to respond to neurotrophins or netrin‐1 with efficient axonal outgrowth. Calcineurin/NFAT signaling is required specifically for axon outgrowth (Graef et al., 2003). AS exerted time‐and‐dose‐ dependent inhibition on the NFATs expression, contributing reduced axon formation with increased apoptosis. A previous study also showed that NFATc3 was capable of regulating the expression of other NFAT family members. Knockdown of NFATc3 leads to the suppression of NFATc1 and NFATc4, while over‐expression of NFATc3 showed opposite effects (X. Zhang et al., 2017). We hence overexpressed NFATc3 in PC12 cells and found that overexpression of NFATc3 stimulated neurite outgrowth and potentiated the effect of NGF, indicating that NFATc3 could be the downstream target of NGF. Involving in both axon outgrowth and neuronal viability, NGF rescued PC12 cells from AS toxicities through regulating the AKT/GSK‐3β/NFAT pathway.
In conclusion, the arsenic‐induced neurotoxicity observed in PC12 cells suggests that AS can be a useful tool for chemical biology investigations in neural systems. Our data show that AS induces mitochondria‐mediated apoptosis in PC12 cells via the inhibition of the AKT/GSK3β/NFAT pathway and highlight the importance of NFATc3 in NGF‐induced neuronal protection (Figure 8).

REFERENCES

Ahn, J., Jang, J., Choi, J., Lee, J., Oh, S. H., Lee, J., … Kim, S. (2014). GSK3beta, but not GSK3alpha, inhibits the neuronal differentiation of neural progenitor cells as a downstream target of mammalian target of rapamycin complex1. Stem Cells and Development, 23(10), 1121–1133.
Arron, J. R., Winslow, M. M., Polleri, A., Chang, C. P., Wu, H., Gao, X., Crabtree, G. R. (2006). NFAT dysregulation by increased dosage of DSCR1 and DYRK1A on chromosome 21. Nature, 441(7093), 595–600.
Beals, C. R. (1997). Nuclear export of NF‐ATc enhanced by glycogen synthase kinase‐3. Science, 275(5308), 1930–1934.
Benedito, A. B., Lehtinen, M., Massol, R., Lopes, U. G., Kirchhausen, T., Rao, A., & Bonni, A. (2005). The transcription factor NFAT3 mediates neuronal survival. Journal of Biological Chemistry, 280(4), 2818–2825.
Ding, W., Tong, Y., Zhang, X., Pan, M., & Chen, S. (2016). Study of arsenic sulfide in solid tumor cells reveals regulation of nuclear factors of activated T‐cells by PML and p53. Scientific Reports, 6, 19793.
Durand, D. B., Shaw, J. P., Bush, M. R., Replogle, R. E., Belagaje, R., & Crabtree, G. R. (1988). Characterization of antigen receptor response elements within the interleukin‐2 enhancer. Molecular and Cellular Biology, 8(4), 1715–1724.
Frankel, S., Concannon, J., Brusky, K., Pietrowicz, E., Giorgianni, S., Thompson, W. D., & Currie, D. A. (2009). Arsenic exposure disrupts neurite growth and complexity in vitro. Neurotoxicology, 30(4), 529–537.
Graef, I. A., Chen, F., & Crabtree, G. R. (2001). NFAT signaling invertebrate development. Current Opinion in Genetics & Development, 11(5), 505–512.
Graef, I. A., Mermelstein, P. G., Stankunas, K., Neilson, J. R., Deisseroth, K., Tsien, R. W., & Crabtree, G. R. (1999). L‐type calcium channels and GSK‐3 regulate the activity of NF‐ATc4 in hippocampal neurons. Nature, 401(6754), 703–708.
Graef, I. A., Wang, F., Charron, F., Chen, L., Neilson, J., Tessier‐Lavigne, M., & Crabtree, G. R. (2003). Neurotrophins and netrins require calcineurin/NFAT signaling to stimulate outgrowth of embryonic axons. Cell, 113(5), 657–670.
Gómez‐Sintes, R., & Lucas, J. J. (2010). NFAT/Fas signaling mediates the neuronal apoptosis and motor side effects of GSK‐3 inhibition in a mouse model of lithium therapy. Journal of Clinical Investigation, 120(7), 2432–2445.
Hardt, S. E., & Sadoshima, J. (2004). Negative regulators of cardiac hypertrophy. Cardiovascular Research, 63(3), 500–509.
Ho, S. N., Thomas, D. J., Timmerman, L. A., Li, X., Francke, U., & Crabtree, G. R. (1995). NFATc3, a lymphoid‐specific NFATc family member that is calcium‐regulated and exhibits distinct DNA binding specificity. Journal of Biological Chemistry, 270(34), 19898–19907.
Hsu, L. I., Hsieh, F. I., Wang, Y. H., Lai, T. S., Wu, M. M., Chen, C. J., … Hsu, K. H. (2017). Arsenic exposure from drinking water and the incidence of CKD in low to moderate exposed areas of Taiwan: A 14‐year prospective study. American Journal of Kidney Diseases, 70(6), 787–797.
Kaidanovich‐Beilin, O., & Woodgett, J. R. (2011). GSK‐3: Functional insights from cell biology and animal models. Frontiers in Molecular Neuroscience, 4, 40.
Kao, S. C., Wu, H., Xie, J., Chang, C. P., Ranish, J. A., Graef, I. A., & Crabtree, G. R. (2009). Calcineurin/NFAT signaling is required for neuregulin‐regulated Schwann cell differentiation. Science, 323 (5914), 651–654.
Kim, M. S., Shutov, L. P., Gnanasekaran, A., Lin, Z., Rysted, J. E., Ulrich, J. D., & Usachev, Y. M. (2014). Nerve growth factor (NGF) regulates activity of nuclear factor of activated T‐cells (NFAT) in neurons via the phosphatidylinositol 3‐kinase (PI3K)‐Akt‐glycogen synthase kinase 3beta (GSK3beta) pathway. Journal of Biological Chemistry, 289(45), 31349–31360.
Kim, W. Y., Wang, X., Wu, Y., Doble, B. W., Patel, S., Woodgett, J. R., & Snider, W. D. (2009). GSK‐3 is a master regulator of neural progenitor homeostasis. Nature Neuroscience, 12(11), 1390–1397.
Kipanyula, M. J., Kimaro, W. H., & Etet, P. F. S. (2016). The emerging roles of the calcineurin‐nuclear factor of activated T‐lymphocytes pathway in nervous system functions and diseases. Journal of Aging Research, 2016. 5081021‐20
Klingseisen, A., & Lyons, D. A. (2018). Axonal regulation of central nervous system myelination: Structure and function. Neuroscientist, 24(1), 7–21.
Mochizuki, H., Yagi, K., Tsuruta, K., Taniguchi, A., Ishii, N., Shiomi, K., & Nakazato, M. (2016). Prolonged central sensory conduction time in patients with chronic arsenic exposure. Journal of the Neurological Sciences, 361, 39–42.
Ranger, A. M., Gerstenfeld, L. C., Wang, J., Kon, T., Bae, H., Gravallese, E. M., … Glimcher, L. H. (2000). The nuclear factor of activated T cells (NFAT) transcription factor NFATp (NFATc2) is a repressor of chondrogenesis. Journal of Experimetnal Medicine, 191(1), 9–22.
Rojanathammanee, L., Floden, A. M., Manocha, G. D., & Combs, C. K. (2015). Attenuation of microglial activation in a mouse model of Alzheimer's disease via NFAT inhibition. Journal of Neuroinflammation, 12, 42.
Serrano‐Pérez, M. C., Fernández, M., Neria, F., Berjón‐Otero, M., Doncel‐Pérez, E., Cano, E., & Tranque, P. (2015). NFAT transcription factors regulate survival, proliferation, migration, and differentiation of neural precursor cells. GLIA, 63(6), 987–1004.
Shaw, J., Utz, P., Durand, D., Toole, J., Emmel, E., & Crabtree, G. (2010). Identification of a putative regulator of early T cell activation genes. Science, 241, 202–205. J Immunol 185(9):4972‐4975
Sińczuk‐Walczak, H., Szymczak, M., & Hałatek, T. (2010). Effects of occupational exposure to arsenic on the nervous system: Clinical and neurophysiological studies. International Journal of Occupational Medicine and Environmental Health, 23(4), 347–355.
Takatoh, J., Prevosto, V., & Wang, F. (2018). Vibrissa sensory neurons: Linking distinct morphology to specific physiology and function. Neuroscience, 368, 109–114.
Wu, Q., Liu, G., Xu, L., Wen, X., Cai, Y., Fan, W., … Li, Q. (2016). Repair of neurological Tideglusib function in response to FK506 through CaN/NFATc1 pathway following traumatic brain injury in rats. Neurochemical Research, 41(10), 2810–2818.
Yang, T., Davis, R. J., & Chow, C. W. (2001). Requirement of two NFATc4 transactivation domains for CBP potentiation. Journal of Biological Chemistry, 276(43), 39569–39576.
Yao, J., Zhao, Q. R., Liu, D. D., Chow, C. W., & Mei, Y. A. (2016). Neuritin Up‐regulates Kv4.2 alpha‐subunit of potassium channel expression and affects neuronal excitability by regulating the calcium‐calcineur- in‐NFATc4 signaling pathway. Journal of Biological Chemistry, 291(33), 17369–17381.
Zhang, L., Tian, W., Kim, S., Ding, W., Tong, Y., & Chen, S. (2015). Arsenic sulfide, the main component of realgar, a traditional Chinese medicine, induces apoptosis of gastric cancer cells in vitro and in vivo. Drug Design, Development and Therapy, 9, 79–92.
Zhang, X., Kang, T., Zhang, L., Tong, Y., Ding, W., & Chen, S. (2017). NFATc3 mediates the sensitivity of gastric cancer cells to arsenic sulfide. Oncotarget, 8(32), 52735–52745.
Zhang, Y., Duan, X., Li, J., Zhao, S., Li, W., Zhao, L., … Li, B. (2016). Inorganic arsenic induces NRF2‐regulated antioxidant defenses in both cerebral cortex and hippocampus in vivo. Neurochemical Research, 41(8), 2119–2128.
Zhou, P., Sun, L. J., Dötsch, V., Wagner, G., & Verdine, G. L. (1998). Solution structure of the core NFATC1/DNA complex. Cell, 92(5), 687–696.